vm13742, vm13742 (genetic_marker) Vaccinium macrocarpon

Marker Overview


Name	vm13742
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TTTATC)4
Primer 1	vm13742.forward primer: TCTTAACCACTTTCTTTGCC
Primer 2	vm13742.reverse primer: GTAAGCCAAGCTTGAGAATATG
Product Length	218
Max Length	224
Publication	[view all]

Publications


Year	Publication
2012	Zhu H, Senalik D, McCown BH, Zeldin EL, Speers J, Hyman J, Bassil N, Hummer K, Simon PW, Zalapa JE. Mining and validation of pyrosequenced simple sequence repeats (SSRs) from American cranberry (Vaccinium macrocarpon Ait.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 Jan; 124(1):87-96.