vm31701, vm31701 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namevm31701
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)11
Primer 1vm31701.forward primer: GTCACTGGTAATGCTATTCTGA
Primer 2vm31701.reverse primer: CTTCTTTGTTTCATCTCCCTAC
Product Length259
Max Length307
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-F1#10_x_W85-23-F1-2017LG06N/A81.2vm31701View
2Cranberry-CNJ02-1-2007LG6N/A97.09vm31701View
3Cranberry-Crimson_Queen-2017LG06N/A69.9vm31701View
4Cranberry-Mullica_Queen-2007LG6N/A113.4vm31701View
5Cranberry-Crimson_Queen-2007LG6N/A84.3vm31701View
6Blueberry-W85-23-2017LG06N/A107.8vm31701View
7Blueberry-F1#10-2017LG06N/A91vm31701View
8Cranberry-Mullica_Queen-2017LG06N/A96.5vm31701View
9Cranberry-CNJ02-1-2017LG06N/A83.5vm31701View
10Cranberry-[BG//BL/BN]95-F1LG06N/A5.97vm31701View
11Cranberry-Composite_map-F1LG06N/A2.78vm31701View
12Cranberry-Crimson_Queen-F1LG06N/A1.19vm31701View
13Cranberry-GH1/35-F1LG06N/A1.71vm31701View
14Cranberry-Mullica_Queen_1-F1LG06N/A2.38vm31701View
15Cranberry-Mullica_Queen_2-F1LG06N/A1.49vm31701View
16Cranberry-Stevens-F1LG06N/A2.99vm31701View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primervm31701.forward primerVaccinium macrocarponprimer
reverse primervm31701.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
vm31701vm31701Vaccinium macrocarponmarker_locus
vm31701vm31701-5.97Vaccinium macrocarponmarker_locus
vm31701vm31701-2.78Vaccinium macrocarponmarker_locus
vm31701vm31701-1.19Vaccinium macrocarponmarker_locus
vm31701vm31701-1.71Vaccinium macrocarponmarker_locus
vm31701vm31701-2.38Vaccinium macrocarponmarker_locus
vm31701vm31701-1.49Vaccinium macrocarponmarker_locus
vm31701vm31701-2.99Vaccinium macrocarponmarker_locus