vm23232, vm23232 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDN/A
SpeciesVaccinium macrocarpon
Repeat Motif(TTGGT)6
Primer 1vm23232.forward primer: ACAGAGCTCAATGGAGAAAA
Primer 2vm23232.reverse primer: TTCTGCTGATAGTGTTGGTACA
Product Length125
Max Length140
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primervm23232.forward primerVaccinium macrocarponprimer
reverse primervm23232.reverse primerVaccinium macrocarponprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
vm23232vm23232Vaccinium macrocarponmarker_locus
vm23232vm23232-99.59Vaccinium macrocarponmarker_locus
vm23232vm23232-88.91Vaccinium macrocarponmarker_locus
vm23232vm23232-75.38Vaccinium macrocarponmarker_locus