vm40600, vm40600 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	vm40600
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)11
Primer 1	vm40600.forward primer: CAAAAGAGCCATGAAATAGG
Primer 2	vm40600.reverse primer: TTGGTGAAAACTATACCTGTCC
Product Length	183
Max Length	208
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr12	supercontig	Vmac_chr12:30574409..30574566 .
chr12	supercontig	chr12:29482795..29482952 .

Publications


Year	Publication
2012	Zhu H, Senalik D, McCown BH, Zeldin EL, Speers J, Hyman J, Bassil N, Hummer K, Simon PW, Zalapa JE. Mining and validation of pyrosequenced simple sequence repeats (SSRs) from American cranberry (Vaccinium macrocarpon Ait.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 Jan; 124(1):87-96.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG12	N/A	23.97	vm40600	View
2	Cranberry-Mullica_Queen-2007	LG12	N/A	30.2	vm40600	View
3	Cranberry-CNJ02-1-2017	LG12	N/A	22.3	vm40600	View
4	Cranberry-Mullica_Queen-2017	LG12	N/A	28	vm40600	View
5	Cranberry-Composite_map-F1	LG12	N/A	65.37	vm40600	View
6	Cranberry-Mullica_Queen_1-F1	LG12	N/A	72.81	vm40600	View