vm45176, vm45176 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	vm45176
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CCG)6
Primer 1	vm45176.forward primer: AGACCTAAAATCACTGCACCT
Primer 2	vm45176.reverse primer: GTGATGTCGATCGTTGATTT
Product Length	249
Max Length	264
Publication	[view all]

Publications


Year	Publication
2012	Zhu H, Senalik D, McCown BH, Zeldin EL, Speers J, Hyman J, Bassil N, Hummer K, Simon PW, Zalapa JE. Mining and validation of pyrosequenced simple sequence repeats (SSRs) from American cranberry (Vaccinium macrocarpon Ait.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 Jan; 124(1):87-96.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr11	supercontig	Vmac_chr11:31077424..31077651 .
chr11	supercontig	chr11:29449495..29449722 .