vm55441, vm55441 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namevm55441
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TA)10
Primer 1vm55441.forward primer: AAAAGGAACACGGATACGAT
Primer 2vm55441.reverse primer: GGATTCGAGAACCTATCTCAT
Product Length172
Max Length216
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A98.32vm55441View
2Cranberry-Mullica_Queen-2007LG1N/A109.8vm55441View
3Cranberry-CNJ02-1-2017LG01N/A95.7vm55441View
4Cranberry-Mullica_Queen-2017LG01N/A106vm55441View
5Cranberry-[BG//BL/BN]95-F1LG01N/A12.51vm55441View
6Cranberry-Composite_map-F1LG01N/A12.85vm55441View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primervm55441.forward primerVaccinium macrocarponprimer
reverse primervm55441.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
vm55441vm55441Vaccinium macrocarponmarker_locus
vm55441vm55441-12.51Vaccinium macrocarponmarker_locus
vm55441vm55441-12.85Vaccinium macrocarponmarker_locus