vm69485, vm69485 (genetic_marker) Vaccinium macrocarpon

Marker Overview


Name	vm69485
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AG)12
Primer 1	vm69485.forward primer: CGAACCCGACAATTAATCTA
Primer 2	vm69485.reverse primer: GCCTCACTGCTATAGTTACAGG
Product Length	169
Max Length	191
Publication	[view all]

Publications


Year	Publication
2012	Zhu H, Senalik D, McCown BH, Zeldin EL, Speers J, Hyman J, Bassil N, Hummer K, Simon PW, Zalapa JE. Mining and validation of pyrosequenced simple sequence repeats (SSRs) from American cranberry (Vaccinium macrocarpon Ait.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2012 Jan; 124(1):87-96.