|
Marker Overview
Name | NCSU_Chr01_11502841 |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | C/T |
5' Flanking Sequence | ataccaacaaccaacacaactagcaagccaatatactaatggctgaaacaaaataaacca
gatgctatgacaaaatcatgacccaccacgaaggaacatc |
3' Flanking Sequence | gacagagtctgaactcatgtataaacaaaagacaaaggattgcttaccaacccatgaaca
attttagatgacagaagaagaactgatgcaataaggtcag |
Species | Vaccinium corymbosum |
Publication | [view all] |
Contact | Massimo Iorizzo
|
Publications
Year | Publication |
2021 | Mengist MF, Bostan H, Young E, Kay KL, Gillitt N, Ballington J, Kay CD, Ferruzzi MG, Ashrafi H, Lila MA, Iorizzo M. High-density linkage map construction and identification of loci regulating fruit quality traits in blueberry.. Horticulture research. 2021 Aug 01; 8(1):169. |
2022 | Mengist MF, Bostan H, De Paola D, Teresi SJ, Platts AE, Cremona G, Xinpeng Q, Mackey T, Bassil NV, Ashrafi H, Giongo L, Jibran R, Chagné D, Bianco L, Lila MA, Rowland LJ, Iovene M, Edger PP, Iorizzo M. Autopolyploid inheritance and a heterozygous reciprocal translocation shape chromosome genetic behavior in tetraploid blueberry (Vaccinium corymbosum).. The New Phytologist. 2022 Aug 13. |
Sequence
>NCSU_Chr01_11502841 ID=NCSU_Chr01_11502841; Name=NCSU_Chr01_11502841; organism=Vaccinium corymbosum; type=genetic_marker; length=201bp ataccaacaaccaacacaactagcaagccaatatactaatggctgaaaca aaataaaccagatgctatgacaaaatcatgacccaccacgaaggaacatc Ygacagagtctgaactcatgtataaacaaaagacaaaggattgcttacca acccatgaacaattttagatgacagaagaagaactgatgcaataaggtca g
Alignments
The following features are aligned
|