scaffold_18824, scaffold_18824 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_18824
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_18824.Forward primer: TGTTCTTAGGGAGTTGAGAGAT
Primer 2scaffold_18824.Reverse Primer: TTACCTCAGTCATTCCTCTAGC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG01N/A50.87scaffold_18824View
2Cranberry-Mullica_Queen_1-F1LG01N/A34.58scaffold_18824View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_18824.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_18824.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_18824scaffold_18824-50.87Vaccinium macrocarponmarker_locus
scaffold_18824scaffold_18824-34.58Vaccinium macrocarponmarker_locus