scaffold_20967, scaffold_20967 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_20967
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_20967.Forward primer: TTCGTTTTAGAGAGAGAGAAGG
Primer 2scaffold_20967.Reverse Primer: GGAAGCAGTGAATATGGAGTAT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen_1-F1LG07N/A4.76scaffold_20967View
2Cranberry-Composite_map-F1LG07N/A4.76scaffold_20967View
3Cranberry-Crimson_Queen-F1LG07N/A5.95scaffold_20967View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_20967.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_20967.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_20967scaffold_20967-4.76Vaccinium macrocarponmarker_locus
scaffold_20967scaffold_20967-5.95Vaccinium macrocarponmarker_locus