scaffold_29411, scaffold_29411 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_29411
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_29411.Forward primer: TCTTACTGAATGCTCTTAGGGT
Primer 2scaffold_29411.Reverse Primer: CTCATTACATCAGCTTGTTAGC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG05N/A47.12scaffold_29411View
2Cranberry-Crimson_Queen-F1LG05N/A41.01scaffold_29411View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_29411.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_29411.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_29411scaffold_29411-47.12Vaccinium macrocarponmarker_locus
scaffold_29411scaffold_29411-41.01Vaccinium macrocarponmarker_locus