scaffold_37046, scaffold_37046 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescaffold_37046
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scaffold_37046.Forward primer: AACACATCTCTTATTACTCGCC
Primer 2scaffold_37046.Reverse Primer: CCTCCTCTCTTGAAAACATCT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Composite_map-F1LG08N/A17.03scaffold_37046View
2Cranberry-Crimson_Queen-F1LG08N/A8.93scaffold_37046View
3Cranberry-Mullica_Queen_1-F1LG08N/A28.25scaffold_37046View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerscaffold_37046.Forward primerVaccinium macrocarponprimer
Reverse Primerscaffold_37046.Reverse PrimerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scaffold_37046scaffold_37046-17.03Vaccinium macrocarponmarker_locus
scaffold_37046scaffold_37046-8.93Vaccinium macrocarponmarker_locus
scaffold_37046scaffold_37046-28.25Vaccinium macrocarponmarker_locus