berc210, berc210 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc210
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc210.forward primer: CGGCCCTAGTTCTCTCACAG
Primer 2	berc210.reverse primer: CAACGGAAGACCAAACCAGT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr11_H1	supercontig	chr11_H1:20142637..20143569 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG8	N/A	46	berc210	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG10	N/A	54.5	berc210	View
3	Blueberry-F1#10-2017	LG10	N/A	76.9	berc210	View