berc230, berc230 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc230
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc230.forward primer: AGGGATTTCGATGGGCTATT
Primer 2	berc230.reverse primer: TGGGGAGAATCACTCTGCAT
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG4	N/A	55	berc230	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG08	N/A	41.2	berc230	View
3	Blueberry-F1#10-2017	LG08	N/A	41.7	berc230	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff20	supercontig	VaccDscaff20:25112818..25114137 .
scaffold00765	supercontig	scaffold00765:53881..55319 .
chr10_H1	supercontig	chr10_H1:30681887..30683219 .
chr8	supercontig	chr8:25241811..25243105 .
Chr10	supercontig	Chr10:9389938..9391264 .