|
Marker Overview
Name | berc363 |
Genbank ID | N/A |
Type | EST marker |
Species | Vaccinium corymbosum |
Primer 1 | berc363.forward primer: GCCGAGGTACATACCCAGAA |
Primer 2 | berc363.reverse primer: CACACCTATGGCTTTCAGCA |
Publication | [view all] |
Publications
Year | Publication |
2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
|