SL188, SL188 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	SL188
Genbank ID	DW043179
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	SL188.forward primer: GAACATCGCCCTTTCGAG
Primer 2	SL188.reverse primer: AAATTTACGGGGGTTCCTTG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	DW043179

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG8	N/A	115	SL188	View