berc523, berc523 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc523
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc523.forward primer: TTGTCAGGTTTCAGCCAGTG
Primer 2	berc523.reverse primer: GCTTTCAACACCCTAGACATCC
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG6	N/A	80	berc523	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG12	N/A	41.2	berc523	View
3	Blueberry-F1#10-2017	LG12	N/A	42.9	berc523	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold00929	supercontig	scaffold00929:29442..30185 .
chr5_H1	supercontig	chr5_H1:23060340..23061023 .
Vmac_chr12	supercontig	Vmac_chr12:15100463..15101047 .
chr12	supercontig	chr12:14128551..14129135 .
Chr05	supercontig	Chr05:14862845..14863428 .
Chr05_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr05_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:18338681..18339264 .