berc781, berc781 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc781
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc781.forward primer: TAGCGTGAGACAAAGGCAAA
Primer 2	berc781.reverse primer: AAGCAACCGCAACTACAGGT
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	139	berc781a	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG03	N/A	77.1	berc781a	View
3	Blueberry-F1#10-2017	LG03	N/A	77.5	berc781a	View
4	Blueberry-F1#10xW85-23-F1	LG12	N/A	65	berc781b	View

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.