berc826, berc826 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc826
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc826.forward primer: CCTTCTCCTCCTCAACTTTGG
Primer 2	berc826.reverse primer: CGAGATGGAAAGCACACAAA
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG6	N/A	114	berc826	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff72	supercontig	VaccDscaff72:665631..666459 .