berc798, berc798 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	berc798
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	berc798.forward primer: GACGACGACAACCCTCTCTC
Primer 2	berc798.reverse primer: TGAGATTCAAGCAAACCATCA
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG9	N/A	29	berc798	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG07	N/A	2.4	berc798	View
3	Blueberry-F1#10-2017	LG07	N/A	2.4	berc798	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
chr12_H1	supercontig	chr12_H1:38531288..38531994 .