CA1049, CA1049 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	CA1049
Genbank ID	CV090219
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	CA1049.forward primer: GTCACAGCTTGGCAATTGAA
Primer 2	CA1049.reverse primer: CGGCTGCTTTCTGATCTACC
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CV090219

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG6	N/A	55	CA1049	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG12	N/A	48.7	CA1049	View
3	Blueberry-F1#10-2017	LG12	N/A	50.1	CA1049	View