CA21, CA21 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	CA21
Genbank ID	CF811092
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	CA21.forward primer: TCCGATAACCGTTACCAAGC
Primer 2	CA21.reverse primer: TATACAGCGACACGCCAAAA
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CF810526
DB:genbank	CF811092

Publications


Year	Publication
2010	Rowland LJ, Ogden EL, Ehlenfeldt MK. EST-PCR markers developed for highbush blueberry are also useful for genetic fingerprinting and relationship studies in rabbiteye blueberry. Scientia horticulturae. 2010; 125(4):779-784.
2003	Rowland LJ, Mehra S, Dhanaraj AL, Ogden EL, Slovin JP, Ehlenfeldt MK. Development of EST-PCR Markers for DNA Fingerprinting and Genetic Relationship Studies in Blueberry (Vaccinium, section Cyanococcus). Journal of the American Society for Horticultural Science. 2003; 128(5):682-690.