CA51, CA51 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	CA51
Genbank ID	N/A
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	CA51.forward primer: GCTGCTCTTGTACAGGGCTC
Primer 2	CA51.reverse primer: TTGCGCACACATAAACCTAAA
Publication	[view all]

Publications


Year	Publication
2010	Rowland LJ, Ogden EL, Ehlenfeldt MK. EST-PCR markers developed for highbush blueberry are also useful for genetic fingerprinting and relationship studies in rabbiteye blueberry. Scientia horticulturae. 2010; 125(4):779-784.
2003	Rowland LJ, Mehra S, Dhanaraj AL, Ogden EL, Slovin JP, Ehlenfeldt MK. Development of EST-PCR Markers for DNA Fingerprinting and Genetic Relationship Studies in Blueberry (Vaccinium, section Cyanococcus). Journal of the American Society for Horticultural Science. 2003; 128(5):682-690.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
scaffold00008	supercontig	scaffold00008:682292..683466 .
Chr11	supercontig	Chr11:33546389..33547873 .