CA221a, CA221a (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	CA221a
Genbank ID	CF810527
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	CA221a.forward primer: GATTAAAAGCGCTTATCGGAAG
Primer 2	CA221a.reverse primer: AACTCCTGCAGGGACTTTAGG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CF810527

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.