CA636S, CA636S (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	CA636S
Genbank ID	CV090796
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	CA636S.forward primer: AAACTACCCGATGTCGATGC
Primer 2	CA636S.reverse primer: TCCATCGATGACGATGAAAA
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CV090796

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG3	N/A	137	CA636S	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG11	N/A	64	CA636S	View
3	Blueberry-F1#10-2017	LG11	N/A	80.2	CA636S	View