GVC-C634, GVC-C634 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	GVC-C634
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	GVC-C634.forward primer: GAGTGCATCCAGAATGAGCA
Primer 2	GVC-C634.reverse primer: TTGGCCAATATGTCTAGGGC
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG10	N/A	119	GVC-C634_272	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr09	supercontig	Vcev1_p0.Chr09:51752359..51752639 .
chr9_H1	supercontig	chr9_H1:42368657..42368939 .
Chr09	supercontig	Chr09:1962525..1962800 .
Chr09_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr09_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:2878993..2879276 .