GVC-C725, GVC-C725 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	GVC-C725
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	GVC-C725.forward primer: TCCACCCACTTCACAGTTCA
Primer 2	GVC-C725.reverse primer: ATTGGGAGGGAATTGGAAAC
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG9	N/A	92	GVC-C725_144	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG07	N/A	42.2	GVC-C725	View
3	Blueberry-F1#10-2017	LG07	N/A	41.8	GVC-C725	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff46	supercontig	VaccDscaff46:10880654..10880795 .
Vmac_chr07	supercontig	Vmac_chr07:24048650..24048830 .
chr7	supercontig	chr7:23075403..23075587 .
Chr12_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr12_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:26230183..26230363 .