KAN08690, KAN08690 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN08690
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TA)7
Primer 1KAN08690.forward primer: AACCTGGAACAAAAGCGTGT
Primer 2KAN08690.reverse primer: CTCACACCCCTTTGCAATTT
Max Length327
Publication[view all]