KAN09946, KAN09946 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN09946
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AT)14
Primer 1KAN09946.forward primer: TTTGAATGCCTTGTTTGCTG
Primer 2KAN09946.reverse primer: CCAAAATCGGCAAGATCCTA
Max Length208
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr02supercontigVcev1_p0.Chr02:1015491..1015677 .