IP5PII-2, IP5PII-2 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	IP5PII-2
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	IP5PII-2.forward primer: ATGGAGTACCAAGGAAAAACGA
Primer 2	IP5PII-2.reverse primer: CCATTTTTATCGGGGTGAGTAA
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG2	N/A	198	IP5PII-2_286	View
2	Blueberry-F1#10xW85-23-F1	LG2	N/A	220	IP5PII-2_234	View
3	Blueberry-F1#10_x_W85-23-F1-2017	LG01	N/A	69.8	IP5PII-2	View
4	Blueberry-F1#10-2017	LG01	N/A	98.3	IP5PII-2	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr02	supercontig	Vcev1_p0.Chr02:8702346..8702606 .
scaffold00661	supercontig	scaffold00661:81653..81898 .
chr2_H1	supercontig	chr2_H1:7089761..7089993 .