GVC-V22g08, GVC-V22g08 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	GVC-V22g08
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	GVC-V22g08.forward primer: CCAGCCCTTCCTTTCTTTCT
Primer 2	GVC-V22g08.reverse primer: GCTGTTGGCAAAGATTCCAT
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG2	N/A	49	GVC-V22g08_204	View
2	Blueberry-Draper	LG12	N/A	71	GVC-v22g08b	View
3	Blueberry-Jewel	LG12b	N/A	48	GVC_V22g08a	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr02	supercontig	Vcev1_p0.Chr02:56308443..56308644 .
VaccDscaff14	supercontig	VaccDscaff14:31581339..31581540 .
scaffold00099	supercontig	scaffold00099:280851..281052 .
Chr02	supercontig	Chr02:39636901..39637102 .