KAN0009C, KAN0009C (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN0009C
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN0009C.forward primer: TTGTTTTGTGTCAAACAATGTACG
Primer 2	KAN0009C.reverse primer: AGATCTGCAGCTCACGTCCT
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG2	N/A	30	KAN-0009C_165	View
2	Blueberry-F1#10xW85-23-F1	LG2	N/A	32	KAN-0009C_160	View
3	Blueberry-F1#10_x_W85-23-F1-2017	LG10	N/A	3.4	KAN-0009C	View
4	Blueberry-F1#10-2017	LG10	N/A	13.5	KAN-0009C	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr07	supercontig	Vcev1_p0.Chr07:5695554..5695707 .
scaffold00009	supercontig	scaffold00009:625222..625455 .
chr7_H1	supercontig	chr7_H1:4076805..4076941 .
11684_pilon_pilon	supercontig	11684_pilon_pilon:76594..76959 .