KAN05321, KAN05321 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN05321
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(TC)6
Primer 1KAN05321.forward primer: CAAAGCCTTGTTCCGGTAGT
Primer 2KAN05321.reverse primer: GGGGGCGGTTTAGTTAGAAG
Max Length227
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr11supercontigVcev1_p0.Chr11:4108182..4108392 .