KAN11118, KAN11118 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN11118
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN11118.forward primer: ACGACCAGTAATCATTCGCC
Primer 2	KAN11118.reverse primer: GGCACAACCCGATCTCTTTA
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG5	N/A	104	KAN-11118	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG04	N/A	41	KAN-11118	View
3	Blueberry-F1#10-2017	LG04	N/A	54.3	KAN-11118	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff9	supercontig	VaccDscaff9:24527786..24528014 .
scaffold01462	supercontig	scaffold01462:2198..2428 .
chr3_H1	supercontig	chr3_H1:28642211..28642431 .
Chr03_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1	chromosome	Chr03_Vaccinium_vitis-idaea_var_RedCandy_RedCandy_UBC_v1:16628170..16628400 .