KAN08193, KAN08193 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN08193
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AAT)6
Primer 1KAN08193.forward primer: GGGTTTCCCTTTGGTCTTGT
Primer 2KAN08193.reverse primer: GGTGCCGTTGTTCAACTTCT
Max Length252
Publication[view all]