KAN08290, KAN08290 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN08290
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AAT)5
Primer 1KAN08290.forward primer: TCCATTCGCGAGAAGACATA
Primer 2KAN08290.reverse primer: GATACGATTGCCGATGAGGT
Max Length263
Publication[view all]
Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
Vcev1_p0.Chr10supercontigVcev1_p0.Chr10:40704578..40704826 .