KAN11281, KAN11281 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameKAN11281
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1KAN11281.forward primer: GGGGTAACATTGACCATTCG
Primer 2KAN11281.reverse primer: AAATCCCTCAATCCAAAGGG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG09N/A3.3KAN-11281View
2Blueberry-F1#10xW85-23-F1LG1N/A53KAN-11281View
3Cranberry-Crimson_Queen-2017LG09N/A4.6KAN-11281View
4Blueberry-F1#10_x_W85-23-F1-2017LG09N/A3.3KAN-11281View
5Blueberry-F1#10-2017LG09N/A4.8KAN-11281View
6Cranberry-Mullica_Queen-2017LG09N/A1.8KAN-11281View
7Cranberry-Composite_map-F1LG09N/A87.09KAN-11281View
8Cranberry-Crimson_Queen-F1LG09N/A66.19KAN-11281View
9Cranberry-Mullica_Queen_1-F1LG09N/A100.16KAN-11281View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerKAN11281.forward primerVaccinium corymbosumprimer
reverse primerKAN11281.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
KAN-11281KAN-11281Vaccinium corymbosummarker_locus
KAN-11281KAN-11281-87.09Vaccinium corymbosummarker_locus
KAN-11281KAN-11281-66.19Vaccinium corymbosummarker_locus
KAN-11281KAN-11281-100.16Vaccinium corymbosummarker_locus