KAN11482, KAN11482 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN11482
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN11482.forward primer: TGTGGTTTGAGGAATGGTGA
Primer 2	KAN11482.reverse primer: TTATTCAGAGCCCCTAGGCA
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG6	N/A	22	KAN-11482_260	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG12	N/A	90.9	KAN-11482	View
3	Blueberry-F1#10-2017	LG12	N/A	94.5	KAN-11482	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr05	supercontig	Vcev1_p0.Chr05:2363462..2363699 .
scaffold01009	supercontig	scaffold01009:43329..43566 .