KAN2459, KAN2459 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	KAN2459
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	KAN2459.forward primer: CCTGCATTTGGTTTTGGTTT
Primer 2	KAN2459.reverse primer: GGCTGGTTTAGGTACGGTGA
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG3	N/A	60	KAN-2459	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG11	N/A	47.8	KAN-2459	View
3	Blueberry-F1#10-2017	LG11	N/A	48.4	KAN-2459	View
4	Blueberry-W85-23-2017	LG11	N/A	29.5	KAN-2459	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr04	supercontig	Vcev1_p0.Chr04:26275451..26275574 .
scaffold00204	supercontig	scaffold00204:82563..82686 .
chr4_H1	supercontig	chr4_H1:21073677..21073800 .
Vmac_chr11	supercontig	Vmac_chr11:18839564..18839699 .
chr11	supercontig	chr11:17388991..17389126 .
Chr04	supercontig	Chr04:18120416..18120535 .