NA1304+, NA1304+ (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	NA1304+
Genbank ID	CV091100
Type	EST marker
Species	Vaccinium corymbosum
Primer 1	NA1304+.forward primer: GGACGGTAAGGAGGAGGAAG
Primer 2	NA1304+.reverse primer: GCAAATCTCCCATTCCACAT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	CV091100

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG5	N/A	32	NA1304+	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG04	N/A	2.5	NA1304+	View
3	Blueberry-F1#10-2017	LG04	N/A	2.4	NA1304+	View