Pr031818818, Pr031818818 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr031818818
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr031818818.forward primer: CGAACGGCCACTTTTAGAGA
Primer 2	Pr031818818.reverse primer: CCCATCAGTGCAGAAGGAA
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG1	N/A	131	Pr031818818	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG02.1	N/A	1.1	Pr031818818	View
3	Blueberry-F1#10-2017	LG02.1	N/A	0	Pr031818818	View
4	Blueberry-W85-23-2017	LG02.1	N/A	0	Pr031818818	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff70	supercontig	VaccDscaff70:55305..55496 .