Pr031818823, Pr031818823 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr031818823
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr031818823.forward primer: AATCTCTGTCGCCCATTTTG
Primer 2	Pr031818823.reverse primer: TTCCCCTGCTTCTGCTGTT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr01	supercontig	Vcev1_p0.Chr01:53235675..53235823 .
Chr01	supercontig	Chr01:4490856..4491021 .

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG7	N/A	25	Pr031818823_170	View
2	Cranberry-Composite_map-F1	LG06	N/A	83.12	Pr031818823	View
3	Cranberry-Crimson_Queen-F1	LG06	N/A	78.28	Pr031818823	View
4	Cranberry-Mullica_Queen_1-F1	LG06	N/A	103.61	Pr031818823	View
5	Blueberry-F1#10_x_W85-23-F1-2017	LG06	N/A	10.4	Pr031818823	View
6	Blueberry-F1#10-2017	LG06	N/A	13.5	Pr031818823	View
7	Cranberry-CNJ02-1-2017	LG06	N/A	0.5	Pr031818823	View
8	Cranberry-Crimson_Queen-2017	LG06	N/A	0.9	Pr031818823	View
9	Cranberry-Mullica_Queen-2017	LG06	N/A	0	Pr031818823	View