Pr031818811, Pr031818811 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	Pr031818811
Genbank ID	N/A
Type	SSR
Species	Vaccinium corymbosum
Primer 1	Pr031818811.forward primer: AAATGCCCCAACAGTCTTCT
Primer 2	Pr031818811.reverse primer: CCGGTCCTCCTAAAAGTAATC
Publication	[view all]

Publications


Year	Publication
2014	Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG7	N/A	89	Pr031818811	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG06	N/A	51	Pr031818811	View
3	Blueberry-F1#10-2017	LG06	N/A	59	Pr031818811	View

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr01	supercontig	Vcev1_p0.Chr01:19459161..19459414 .
scaffold00778	supercontig	scaffold00778:56340..56593 .