Pr031818814, Pr031818814 (genetic_marker) Vaccinium corymbosum

Marker Overview
NamePr031818814
Genbank IDN/A
TypeSSR
SpeciesVaccinium corymbosum
Primer 1Pr031818814.forward primer: CTCACCCATCCTTCTCCTCT
Primer 2Pr031818814.reverse primer: CGGTGTTGATGTCATGCTT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG09N/A61.2Pr031818814View
2Cranberry-Crimson_Queen-2017LG09N/A46.4Pr031818814View
3Blueberry-F1#10_x_W85-23-F1-2017LG09N/A26.3Pr031818814View
4Cranberry-CNJ02-1-2017LG09N/A53.2Pr031818814View
5Blueberry-F1#10-2017LG09N/A60.7Pr031818814View
6Blueberry-F1#10xW85-23-F1LG1N/A122Pr031818814View
7Cranberry-Composite_map-F1LG09N/A32.8Pr031818814View
8Cranberry-Crimson_Queen-F1LG09N/A23.89Pr031818814View
9Cranberry-Mullica_Queen_1-F1LG09N/A38.18Pr031818814View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerPr031818814.forward primerVaccinium corymbosumprimer
reverse primerPr031818814.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
Pr031818814Pr031818814Vaccinium corymbosummarker_locus
Pr031818814Pr031818814-32.8Vaccinium corymbosummarker_locus
Pr031818814Pr031818814-23.89Vaccinium corymbosummarker_locus
Pr031818814Pr031818814-38.18Vaccinium corymbosummarker_locus