|
Marker Overview
Name | Pr031818814 |
Genbank ID | N/A |
Type | SSR |
Species | Vaccinium corymbosum |
Primer 1 | Pr031818814.forward primer: CTCACCCATCCTTCTCCTCT |
Primer 2 | Pr031818814.reverse primer: CGGTGTTGATGTCATGCTT |
Publication | [view all] |
Publications
Year | Publication |
2014 | Rowland LJ, Ogden EL, Bassil N, Buck EJ, McCallum S, Graham J, Brown A, Wiedow C, Campbell AM, Haynes KG, Vinyard BT. Construction of a genetic linkage map of an interspecific diploid blueberry population and identification of QTL for chilling requirement and cold hardiness. Molecular breeding. 2014; 34(4):2033-2048. |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
|