VCBC04624, VCBC04624 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	VCBC04624
Genbank ID	N/A
Type	EST-SSR
Species	Vaccinium corymbosum
Repeat Motif	(ctc)5
Primer 1	VCBC04624.forward primer: GTTCATCCCAATGCAGAAGAAG
Primer 2	VCBC04624.reverse primer: CCTCTTGTGGGTTAGGGTTTCT
Max Length	120
Publication	[view all]

Publications


Year	Publication
2012	Rowland LJ, Alkharouf N, Darwish O, Ogden EL, Polashock JJ, Bassil NV, Main D. Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation. BMC plant biology. 2012; 12:46.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Blueberry-F1#10xW85-23-F1	LG7	N/A	110	VCB-C04624_95	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG06	N/A	65.2	VCBC04624	View
3	Blueberry-F1#10-2017	LG06	N/A	76.4	VCBC04624	View