VCBC05127, VCBC05127 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	VCBC05127
Genbank ID	N/A
Type	EST-SSR
Species	Vaccinium corymbosum
Repeat Motif	(ga)5
Primer 1	VCBC05127.forward primer: CAAAATGGTGAGTTCCTTGTGA
Primer 2	VCBC05127.reverse primer: GTCAATCGAGGTCAAGAAAACC
Max Length	247
Publication	[view all]

Publications


Year	Publication
2012	Rowland LJ, Alkharouf N, Darwish O, Ogden EL, Polashock JJ, Bassil NV, Main D. Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation. BMC plant biology. 2012; 12:46.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr05	supercontig	Vcev1_p0.Chr05:31618304..31618530 .
VaccDscaff18	supercontig	VaccDscaff18:20301152..20301369 .
chr5_H1	supercontig	chr5_H1:25331540..25331766 .
Chr05	supercontig	Chr05:16994051..16994268 .
Chr05_Vaccinium_vitis-idaea_ssp_minus	chromosome	Chr05_Vaccinium_vitis-idaea_ssp_minus:20841133..20841357 .