VCBC13779, VCBC13779 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	VCBC13779
Genbank ID	N/A
Type	EST-SSR
Species	Vaccinium corymbosum
Repeat Motif	(tc)5
Primer 1	VCBC13779.forward primer: GGCTTGCAACATACTCTACAAGG
Primer 2	VCBC13779.reverse primer: ACTGCTTGTTGATTCCTGACCT
Max Length	292
Publication	[view all]

Publications


Year	Publication
2012	Rowland LJ, Alkharouf N, Darwish O, Ogden EL, Polashock JJ, Bassil NV, Main D. Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation. BMC plant biology. 2012; 12:46.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Chr02	supercontig	Chr02:34426893..34427141 .