VCC_B3, VCC_B3 (genetic_marker) Vaccinium corymbosum

Marker Overview
NameVCC_B3
Genbank IDAY842445
TypeSSR
SpeciesVaccinium corymbosum
Repeat Motif(AG)9
Primer 1VCC_B3.forward primer: CCTTCGATCTTGTTCCTTGC
Primer 2VCC_B3.reverse primer: GTTTGATGCAATTGAGGTGGAGA
Max Length250
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Blueberry-JewelLG10bN/A81VCC_B3View
2Cranberry-CNJ02-1-2017LG02N/A13.3VCC_B3View
3Cranberry-Mullica_Queen-2017LG02N/A14.6VCC_B3View
4Cranberry-Mullica_Queen-2007LG2N/A14.6VCC_B3View
5Cranberry-CNJ02-1-2007LG2N/A11.79VCC_B3View
6Cranberry-Unifiedmap2013LG8N/A76.4VCC_B3View
7Cranberry-Composite_map-F1LG02N/A90.92VCC_B3View
8Cranberry-Mullica_Queen_1-F1LG02N/A101.29VCC_B3View
9Cranberry-BB/CQ-F1LG08N/A80.09VCC_B3View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankAY842445
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerVCC_B3.forward primerVaccinium corymbosumprimer
reverse primerVCC_B3.reverse primerVaccinium corymbosumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
VCC_B3VCC_B3Vaccinium corymbosummarker_locus
VCC_B3VCC_B3-90.92Vaccinium corymbosummarker_locus
VCC_B3VCC_B3-101.29Vaccinium corymbosummarker_locus
VCC_B3VCC_B3-80.091Vaccinium corymbosummarker_locus