|
Marker Overview
Name | vco01-2ms4 |
Genbank ID | N/A |
Type | EST-SSR |
Species | Vaccinium corymbosum |
Repeat Motif | (CAGA)3 |
Primer 1 | vco01-2ms4.forward primer: TTGGGGTTGGCTACATGAAT |
Primer 2 | vco01-2ms4.reverse primer: TGAAAGCATCCCCCTTTATG |
Max Length | 312 |
Publication | [view all] |
Publications
Year | Publication |
2014 | Bian Y, Ballington J, Raja A, Brouwer C, Reid R, Burke M, Wang X, Rowland LJ, Bassil N, Brown A. Patterns of simple sequence repeats in cultivated blueberries (Vaccinium section Cyanococcus spp.) and their use in revealing genetic diversity and population structure. Molecular breeding. 2014; 34(2):675-689. |
2005 | Boches P, Bassil N, Rowland L. Microsatellite markers for Vaccinium from EST and genomic libraries. Molecular ecology notes. 2005; 5(3):657-660. |
|