VCBC12112, VCBC12112 (genetic_marker) Vaccinium corymbosum | GDV

Marker Overview

Marker Overview


Name	VCBC12112
Genbank ID	N/A
Type	EST-SSR
Species	Vaccinium corymbosum
Repeat Motif	(agg)4
Primer 1	VCBC12112.forward primer: TTCTTACCCCATAAATGCAAGG
Primer 2	VCBC12112.reverse primer: TTACAACCGTAACGAAGTGTGG
Product Length	300
Publication	[view all]

Publications


Year	Publication
2012	Rowland LJ, Alkharouf N, Darwish O, Ogden EL, Polashock JJ, Bassil NV, Main D. Generation and analysis of blueberry transcriptome sequences from leaves, developing fruit, and flower buds from cold acclimation through deacclimation. BMC plant biology. 2012; 12:46.

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr12	supercontig	Vcev1_p0.Chr12:31909991..31911309 .
scaffold02946	supercontig	scaffold02946:4049..5132 .